Journal: Molecular Nutrition & Food Research

Article Title: Branched‐Chain Amino Acids and Mitochondrial Biogenesis: An Overview and Mechanistic Summary

doi: 10.1002/mnfr.202200109

Figure Lengend Snippet: Current evidence on the effect of BCAA on various indicators of mitochondrial biogenesis and related metabolism in metabolically consequential cell types using in vitro experimental models

Article Snippet: C2C12 myotubes , HMB 6.25 μM, 24 h , ↓ Ppargc1a , Tfam , ↔ Nrf1 , Sirt1 , Sirt3 mRNA expression , Schnuck 2016 [ ] .

Techniques: Metabolic Labelling, In Vitro, Expressing, Activity Assay, Control

Journal: The Journal of Biological Chemistry

Article Title: Phosphorylation of α-dystrobrevin is essential for αkap accumulation and acetylcholine receptor stability

doi: 10.1074/jbc.RA120.013952

Figure Lengend Snippet: αkap forms complexes with α-dbn and AChR in muscle cells and HEK cells. A, lysates from C2C12 myotubes were incubated BTX–biotin, and then biotin-containing complexes were isolated with NeutrAvidin beads. Pulldown proteins (PD) were probed with anti-αkap, anti-AChRα, and anti–α-dbn antibodies. B, lysates from HEK293T cells co-transfected with AChRα and αkap–HA (hemagglutinin) were immunoprecipitated (IP) with anti-HA followed by protein A/G–agarose beads and blotted (IB) with anti-αkap, anti-AChRα, and anti–α-dbn anti-antibodies. Western blotting analysis of cell lysate inputs is shown (left panels).

Article Snippet: Differentiated myotubes were treated with C-terminal agrin (550-AG; R&D Systems) at a concentration of 500 ng/ml overnight.

Techniques: Incubation, Isolation, Transfection, Immunoprecipitation, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Phosphorylation of α-dystrobrevin is essential for αkap accumulation and acetylcholine receptor stability

doi: 10.1074/jbc.RA120.013952

Figure Lengend Snippet: AChRα expression is enhanced in presence of α-dystrobrevin and αkap. A, Western blots of αkap, α-dbn, and AChRα expression in C2C12 myoblasts, myotubes, HEK cells, and HeLa cells. Note that HeLa cells do not express these proteins, whereas HEK cells express only α-dbn1. C2C12 myotubes express all these proteins (AChR, α-dbn (1 and 2), and αkap), whereas myoblasts express only α-dbn and αkap. Tubulin was used as a loading control. B, HeLa cells were transfected with the same amount of AChRα (1 µg) construct and either individual αkap–GFP (0.4 µg), α-dbn–GFP (0.4 µg), or both (0.4 µg of each) constructs. mCherry was used as a control for the transfection efficiency and for the loading of total proteins. C, scatter plot summarizing quantification from four independent blots (data are presented as means ± S.D.). Statistical analysis was done by one-way ANOVA (F = 22.30) followed by Tukey's post hoc multiple comparisons test. ****, P < 0.0001; ***, P < 0.001; **, P < 0.01; *, P < 0.05. n.s, not significant. D, HEK cells were transfected with the same amount of AChRα (1 μg) and with increasing amounts of αkap–GFP (0, 0.2, 0.4, and 0.8 μg). Enhanced GFP (eGFP) was used as a control for the transfection efficiency and for the loading of total proteins with tubulin. Note that in the presence of αdbn, the expression levels of AChRα subunit depend on αkap concentration.

Article Snippet: Differentiated myotubes were treated with C-terminal agrin (550-AG; R&D Systems) at a concentration of 500 ng/ml overnight.

Techniques: Expressing, Western Blot, Control, Transfection, Construct, Concentration Assay

Journal: The Journal of Biological Chemistry

Article Title: Phosphorylation of α-dystrobrevin is essential for αkap accumulation and acetylcholine receptor stability

doi: 10.1074/jbc.RA120.013952

Figure Lengend Snippet: α-Dystrobrevin-1 promotes the expression levels of αkap in transfected cell lines. HeLa, HEK, and C2C12 cells were co-transfected with αkap–GFP (1 µg) and α-dbn–GFP (1 µg) plasmids, and 24 h later lysates from these cells were probed with anti-GFP, anti–α-dbn, and anti-αkap antibodies. A, Western blots of lysates from HeLa cells. Enhanced GFP (eGFP) was used as a control for the transfection efficiency and for the loading of total proteins. B, quantification of blots from independent replicates of experiments as in A (n = 13). C, examples of HeLa cells co-transfected with mCherry and GFP constructs (left column), GFP and αkap–mCherry (1 µg) constructs (middle column), and αkap–mCherry (1 µg) α-dbn–GFP (1 µg) (right column). Note the co-localization (yellow) between (red) αkap–mCherry and (green) α-dbn–GFP (white arrows) in intracellular vesicles. Arrowheads indicate the presence of green only (absence of co-localization). D, Western blotting of lysates from HEK cells. E, quantification of blots as in D (n = 4). F, Western blotting of lysates from C2C12 myotubes. G, quantification of blots showing an increase of both exogenous αkap–GFP (n = 8) and endogenous αkap (n = 6) expression levels. Statistical analysis was done by Student's t test. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Article Snippet: Differentiated myotubes were treated with C-terminal agrin (550-AG; R&D Systems) at a concentration of 500 ng/ml overnight.

Techniques: Expressing, Transfection, Western Blot, Control, Construct

Journal: The Journal of Biological Chemistry

Article Title: Phosphorylation of α-dystrobrevin is essential for αkap accumulation and acetylcholine receptor stability

doi: 10.1074/jbc.RA120.013952

Figure Lengend Snippet: Overexpression of α-dbn and/or αkap in myotubes increased the length and area of agrin-induced AChR clusters. C2C12 myoblasts were transfected with αkap–mCherry and/or α-dystrobrevin–GFP, and differentiated myotubes were treated with agrin overnight, fixed with PFA, and bathed with a fluorescent BTX (Alexa 488 or Alexa 594) to label superficial receptor clusters. AChR clusters on transfected and nontransfected myotubes were imaged, and their area and length were measured and compared with nontransfected myotubes within the same culture dish. A, C, and E, examples of myotubes transfected with α-dbn–GFP (A), αkap–mCherry (C), and αkap–mCherry and α-dbn–GFP (E). B, D, and F, quantification of clusters area and length of AChRs. Note that both the area and length of AChR clusters in transfected group (α-dbn–GFP, αkap–mCherry, and α-dbn–GFP/αkap mCherry; see arrows) are significantly increased compared with the neighboring nontransfected group (asterisks). The data are presented as means ± S.D. For statistical analyses, unpaired t tests were used. ***, P < 0.001; ****, P < 0.0001.

Article Snippet: Differentiated myotubes were treated with C-terminal agrin (550-AG; R&D Systems) at a concentration of 500 ng/ml overnight.

Techniques: Over Expression, Transfection

Journal: Neoplasia (New York, N.Y.)

Article Title: Amelioration of muscle wasting by gintonin in cancer cachexia

doi: 10.1016/j.neo.2021.11.008

Figure Lengend Snippet: GT protects C2C12 myotubes from TNFα/IFNγ-induced muscle cell atrophy. (A-C) C2C12 myotubes were treated with GT for 48 h at the indicated concentration and stained with anti-MHC Ab. (A) Representative images were shown. (B) Average myotube diameter was measured by ImageJ software. (C) The number of nuclei per myotube was quantified. The data were shown as mean ± SEM of more than 100 myotubes from 10 randomly chosen fields (* P ≤ 0.05; *** P ≤ 0.0001). (D-F) C2C12 myotubes were treated with GT at the indicated concentrations together with TNFα (20 ng/mL) and IFNγ (100U/mL) for 24 h, and then stained with anti-MHC Ab. (D) Representative images were shown. (E) Average myotube diameter was measured by ImageJ software. (F) The number of nuclei per myotube was quantified. The data were shown as mean ± SEM of more than 100 myotubes from 10 randomly chosen fields (* P ≤ 0.05; *** P ≤ 0.0001). (G-I) C2C12 myotubes were pre-treated with TNFα (20 ng/mL) and IFNγ (100U/mL) for 24 h, and then treated with GT (100 ng/mL) for 24 h. Cells were stained with anti-MHC Ab. (G) Representative images were shown. (H) Average myotube diameter was measured by ImageJ software. (I) The number of nuclei per myotube was quantified. The data were shown as mean ± SEM of more than 100 myotubes from 10 randomly chosen fields (* P ≤ 0.05; *** P ≤ 0.0001). (J-K) C2C12 myotubes were treated with GT (100 ng/mL) together with TNFα (20 ng/mL) and IFNγ (100U/mL). Cells were isolated, and the protein levels of Atrogin-1 and MuRF-1 were evaluated by western blot. (J) Representative images were shown. (K) Images were measured by ImageJ software. The data were shown as mean ± SEM ( n =3; * P ≤ 0.05).

Article Snippet: Then, myotubes were washed, incubated with 20 μM of DCFDA solution (ab113851, Abcam) for 45 min at 37°C in the darkness, and washed with the 1X buffer according to the manufacturer's protocol.

Techniques: Concentration Assay, Staining, Software, Isolation, Western Blot

Journal: Neoplasia (New York, N.Y.)

Article Title: Amelioration of muscle wasting by gintonin in cancer cachexia

doi: 10.1016/j.neo.2021.11.008

Figure Lengend Snippet: GT protects against cellular atrophy through the lysophosphatidic acid receptor (LPAR) and Gαi2 activation. (A) C2C12 myotubes were treated with GT (100 ng/mL) for 24 h and then the expression of LPARs were quantified by RT-PCR. The data were shown as mean ± SEM of three independent experiments (* P ≤ 0.05; ns, not significant). (B–D) C2C12 myotubes were treated with GT (100 ng/mL), TNFα (20 ng/mL) and IFNγ (100U/mL), or Ki16425 (10 μM) for 24 h and then stained with anti-MHC Ab. (B) Representative images were shown. (C) Average myotube diameters and (D) the number of nuclei per myotube of more than 100 myotubes from 10 randomly chosen fields for each condition were measured by ImageJ software. The data were shown as mean ± SEM (* P ≤ 0.05; *** P ≤ 0.0001). (E-F) C2C12 cells were transfected with control (non-targeting) (siCtrl) or Gαi2 siRNA. (E) mRNA level of Gαi2 was evaluated by RT-PCR and (F, G) protein level of Gαi2 was evaluated by western blot. The data were shown as mean ± SEM of 2 independent experiments ((* P ≤ 0.05; *** P ≤ 0.0001). (H, I) The transfected cells were differentiated to myotubes for 4 days and treated with GT (100 ng/mL) for 48 h. (H) Representative images were shown. (I) Average myotube diameters of more than 100 myotubes from 10 randomly chosen fields of each condition were measured by ImageJ software. The data were shown as mean ± SEM (* P ≤ 0.05;*** P ≤ 0.001; ns, not significant).

Article Snippet: Then, myotubes were washed, incubated with 20 μM of DCFDA solution (ab113851, Abcam) for 45 min at 37°C in the darkness, and washed with the 1X buffer according to the manufacturer's protocol.

Techniques: Activation Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Staining, Software, Transfection, Control, Western Blot

Journal: Neoplasia (New York, N.Y.)

Article Title: Amelioration of muscle wasting by gintonin in cancer cachexia

doi: 10.1016/j.neo.2021.11.008

Figure Lengend Snippet: GT protects C2C12 myoblast from oxidative stress through the reduction of ROS and inflammation genes. (A, B) C2C12 myoblast was incubated for 4 h with TNFα (20 ng/mL), GT (100 ng/mL), or N-acetyl cysteine (NAC) as indicated, and then ROS levels were measured by flow cytometry. NAC was used as a negative control. (A) Representative FACS profiles were shown and (B) the data were presented as mean ± SEM of four independent experiments (* P ≤ 0.05; ***P ≤ 0.0001). (C, D) C2C12 myotube was incubated with TNFα (20 ng/mL) and GT (100 ng/mL) for 4 h as indicated, and then ROS levels were measured by fluorescence microscope. (C) Representative fluorescence images were shown and (D) fluorescence intensity were quantified using the ImageJ software. The data were presented as mean ± SEM of at least 10 randomly chosen fields of each condition (*** P ≤ 0.0001). (E, F) C2C12 myoblast was incubated for 24 h with TNFα (20 ng/mL) or GT (100ng/mL) as indicated, and mitochondria ROS were measured by flow cytometry. (E) Representative FACS profiles were shown and (F) the data were presented as mean ± SEM of four independent experiments (* P ≤ 0.05; *** P ≤ 0.0001). (G, H) C2C12 myoblast was incubated for 24 h with TNFα (20 ng/mL) or GT (100ng/mL) as indicated, and mitochondrial membrane potential (ΔѰm) were measured by flow cytometry. (G) Representative FACS profiles were shown and (H) the data were presented as mean ± SEM of five independent experiments (* P ≤ 0.05). (I) The effect of GT on scavenging of hydroxyl radical was analyzed using iron (II)-dependent TBA reactive substance. Ascorbic acid (AA) was used as a positive control. Data were shown as mean ± SEM of three independent experiments (* P ≤ 0.05; *** P ≤ 0.0001). (J, K) C2C12 myotubes were treated for 24 h with TI (TNFα at 20 ng/mL and IFNγ at 100U/mL) or GT (100 ng/mL) as indicated, and then the levels of IL-6 (J) and Nox-2 (K) were quantified by RT-PCR. The data were shown as mean ± SEM of three to four independent experiments (*, P ≤ 0.05).

Article Snippet: Then, myotubes were washed, incubated with 20 μM of DCFDA solution (ab113851, Abcam) for 45 min at 37°C in the darkness, and washed with the 1X buffer according to the manufacturer's protocol.

Techniques: Incubation, Flow Cytometry, Negative Control, Fluorescence, Microscopy, Software, Membrane, Positive Control, Reverse Transcription Polymerase Chain Reaction

Journal: Neoplasia (New York, N.Y.)

Article Title: Amelioration of muscle wasting by gintonin in cancer cachexia

doi: 10.1016/j.neo.2021.11.008

Figure Lengend Snippet: GT protects against the atrophy of primary normal Human Skeletal Myoblasts (HSkM). (A–C) HSkM myoblast were differentiated to myotube for 7 days in differentiation media. Differentiated cells were treated with different concentrations of GT in the presence or absence of TNFα (10 ng/mL) for 3 days and then stained with anti-MHC Ab. (A) Representative images of myotube cultures were captured with a phase-contrast microscope (100x magnification). (B) Average myotube diameters and (C) the number of nuclei per myotube were quantified from more than 100 myotubes in 10 randomly chosen fields of each condition using ImageJ software. The data were shown as mean ± SEM (* P ≤ 0.05; *** P ≤ 0.0001). (D, E) HSkM myotubes were treated with GT (100 ng/mL) together with TNFα (10 ng/mL) for 8 h. Cells then were isolated, and the protein levels of Atrogin-1 and MuRF-1 were evaluated by western blot. (D) Representative images were shown. (E) Images were measured by ImageJ software. The data were shown as mean ± SEM ( n =3; * P ≤ 0.05).

Article Snippet: Then, myotubes were washed, incubated with 20 μM of DCFDA solution (ab113851, Abcam) for 45 min at 37°C in the darkness, and washed with the 1X buffer according to the manufacturer's protocol.

Techniques: Staining, Microscopy, Software, Isolation, Western Blot

Journal: Journal of Biological Chemistry

Article Title: Znt7-null Mice Are More Susceptible to Diet-induced Glucose Intolerance and Insulin Resistance

doi: 10.1074/jbc.m111.309666

Figure Lengend Snippet: FIGURE 3. mRNA expression of insulin-responsive genes in Znt7 KO and control myotubes. Myoblasts of both genotypes were allowed to differentiate for 6 days before harvest for total RNA isolation or for insulin treatment before RNA isolation. The amount of the target mRNA was measured by a SYBR-based quantitative RT-PCR and analyzed using REST 2009 software (45). Actb and 2m were used as the internal references, and two independent experiments, each with three independent primary myotube lines (both genotypes), were performed. Data were plotted as whisker boxes representing the relative transcription levels of Insr, Irs1, Irs2, Akt1, and Glut4. The horizontal dotted lines in the boxes represent the median values, and the boxes represent the middle 50% of the observations. The top and bottom whiskers (vertical lines) represent the upper 25% and lower 25% of observations, respectively. A, myotubes of both genotypes were harvested for total RNA isolation and quantitative RT-PCR analysis after a 6-day differentiation. The expression of Insr, Irs1, Irs2, Akt1, and Glut4 in Znt7 KO myotubes was compared with their transcription in the wild type control. **, p 0.01. B, after differentiation, myotubes of both genotypes were preincubated with supplement-free medium for 3 h followed by either 0 or 100 nM insulin treatment (7 min) before harvest. The expression of Insr, Irs1, Irs2, Akt1, and Glut4 in the indicated samples was compared with their transcription in the 0 nM insulin-treated controls. *, p 0.05.

Article Snippet: Eleven (primary myoblasts) or 15 (L6/ZnT7Myc and control myotubes) micrograms of protein lysate were loaded on 7.5% (primary myoblasts) or 4–20% (L6/ZnT7-Myc and control myotubes) Tris/glycine gels (Bio-Rad).

Techniques: Expressing, Control, Isolation, Quantitative RT-PCR, Software, Whisker Assay

Journal: Journal of Biological Chemistry

Article Title: Znt7-null Mice Are More Susceptible to Diet-induced Glucose Intolerance and Insulin Resistance

doi: 10.1074/jbc.m111.309666

Figure Lengend Snippet: FIGURE4.AnalysisofL6cellsexpressingZnT7-Mycprotein.A,subcellularlocalizationofendogenousZnT7orexogenousZnT7-MycproteininL6myoblasts. Cells were grown in the complete -MEM for 48 h before staining. ZnT7 was detected by the ZnT7 antibody (20), and ZnT7-Myc was detected by the Myc antibody. B, mRNA expression of insulin-responsive genes in ZnT7-Myc-expressing or vector control L6 myotubes. ZnT7-Myc-expressing and vector control L6 myoblasts were allowed to differentiate for 6 days to myotubes. Myotubes were then preincubated in supplement-free DMEM at 37 °C for 3 h and treated with 0, 10, or 100 nM insulin at 37 °C for 7 min before harvest. The amount of the target mRNA was measured by a SYBR-based quantitative RT-PCR and analyzed using REST 2009 software (45). Actb and 2m were used as the internal references. The data were obtained from three individual L6 stable cell lines for either ZnT7-Myc-expression or vector control. The experiments were performed twice in duplicate. The data were plotted as whisker boxes representing the relative transcription levels of Insr, Irs1, Irs2, Akt1, and Glut4. The horizontal dotted lines in the boxes represent the median values, and the boxes represent the middle 50% of the observations. The top and bottom whiskers (vertical lines) represent the upper 25% and lower 25% of observations, respectively. The expression of Insr, Irs1, Irs2, Akt1, and Glut4 in the indicated samples was compared with the expression of the genes in 0 nM insulin-treated L6 vector control cells. C, expression of phosphorylated Irs2. D, expression of phosphorylated Akt. ZnT7-Myc-expressing myotubes and vector control were preincubated with supplement-free medium for 3 h followed by either 0 or 10 nM insulin treatment (7 min) before harvest. The densities of the protein bands of pIrs2, pAkt, and Actb were determined by Image Lab 2.0.1 software (Bio-Rad). The expression of pIrs2 and pAkt was normalized to the expression of Actb. Three individual L6/ZnT7-Myc and three individual control myotube lines were used in the experiments. Data are reported as mean S.E. (error bars) of three independent experiments (n 9–10). *, p 0.05; **, p 0.01.

Article Snippet: Eleven (primary myoblasts) or 15 (L6/ZnT7Myc and control myotubes) micrograms of protein lysate were loaded on 7.5% (primary myoblasts) or 4–20% (L6/ZnT7-Myc and control myotubes) Tris/glycine gels (Bio-Rad).

Techniques: Staining, Expressing, Plasmid Preparation, Control, Quantitative RT-PCR, Software, Stable Transfection, Whisker Assay

Journal: Journal of Biological Chemistry

Article Title: Znt7-null Mice Are More Susceptible to Diet-induced Glucose Intolerance and Insulin Resistance

doi: 10.1074/jbc.m111.309666

Figure Lengend Snippet: FIGURE 5. [14C]2-DG uptake in L6/ZnT7-Myc and control myotubes. L6/ZnT7-Myc and control myoblasts were allowed to differentiate to myo- tubes and preincubated with medium containing 0.2% FBS for 16 h before the uptake assay. Cells were then serum-starved in -MEM containing 75 M ZnSO4 for 4 h, followed by a 60-min incubation in KRH buffer containing 75 M ZnSO4. Insulin (0, 10, or 100 nM) was added for 15 min, followed by 10 M [14C]2-DG plus 100 M unlabeled glucose for 15 min. The [14C]2-DG uptake was expressed per min per mg of lysate protein. Two individual cell lines of L6/ZnT7-Myc and two individual control cell lines were used in the uptake experiments. Data are reported as mean S.E. (error bars) of three independ- ent experiments in triplicate (n 16–18). *, p 0.05 versus control basal; **, p 0.01 versus control basal; #, p 0.05 versus L6/ZnT7 basal; ##, p 0.01 versus L6/ZnT7 basal; a, p 0.05 versus control treated with 10 nM insulin; b, p 0.05 versus control treated with 100 nM insulin.

Article Snippet: Eleven (primary myoblasts) or 15 (L6/ZnT7Myc and control myotubes) micrograms of protein lysate were loaded on 7.5% (primary myoblasts) or 4–20% (L6/ZnT7-Myc and control myotubes) Tris/glycine gels (Bio-Rad).

Techniques: Control, Incubation

Journal: bioRxiv

Article Title: Rescue of aged muscle stem cell intrinsic quiescence defects by AKT inhibition revealed with a 3D biomimetic culture assay

doi: 10.1101/2022.06.15.496252

Figure Lengend Snippet: (A) Schematic overview of the strategy used to generate myotube templates with an associated timeline for downstream culture (made with BioRender). (B) Representative confocal stitched images of myotube templates labelled for sarcomeric α-actinin (SAA) (magenta) at days 2, 5, 10, 14, 16, and 18 of culture. Scale bar, 1 mm. (C) Representative confocal image of myotubes at day 5 labelled with DAPI (cyan) and SAA (magenta). Scale bar, 50 µm. (D) Quantification of SAA area coverage (left-axis) and nuclear fusion index (right-axis) of myotube templates at days 2, 5, 10, 14, 16, and 18 of culture. n=9-16 across N=3-6 independent biological replicates. Graph displays mean ± s.e.m.; one-way ANOVA with Tukey post-test, minimum *** p=0.002 (SAA coverage) **** p<0.0001 (nuclear fusion index). (E) Optical density (OD) at 490 nm of media after myotube template incubation with MTS assay reagent on days 2, 5, 10, 14, 16, and 18 of culture. n=9-12 across N=3-4 independent biological replicates. Graph displays mean ± s.e.m.; one-way ANOVA with Tukey post-test, ** p=0.0033.

Article Snippet: One day prior to seeding myotube templates, black 96-well clear bottom plates (PerkinElmer, #6055300) were coated with 5 % pluronic acid (Sigma-Aldrich, #P2443) and incubated overnight at 4 °C.

Techniques: Incubation, MTS Assay

Journal: bioRxiv

Article Title: Rescue of aged muscle stem cell intrinsic quiescence defects by AKT inhibition revealed with a 3D biomimetic culture assay

doi: 10.1101/2022.06.15.496252

Figure Lengend Snippet: (A) Schematic overview of the engraftment of freshly isolated MuSCs and the timeline for downstream analysis (made with BioRender). (B) Representative confocal images of myotube templates (phalloidin: magenta) with engrafted MuSCs (YFP: yellow, Pax7: white, white arrows) at 1, 3 and 7 days post-engraftment (DPE). Scale bar, 50 µm. (C) Representative confocal image of a donor MuSC (DAPI: cyan, YFP: yellow, Pax7: white) indicated with a white arrow, and myotubes (phalloidin: magenta) at 7 DPE. Scale bar, 20 µm. (D) Quantification of mononuclear DAPI + YFP + Pax7 + cell density per mm 2 at 1, 3 and 7 DPE across different starting MuSC engraftment numbers (200, 500, 1500, and 2500). n=9-15 across N=3-5 independent biological replicates. Graph displays mean ± s.e.m.; one-way ANOVA with Dunnet test for each individual timepoint comparing against the 500 MuSC condition, ** p=0.0025, 0.0051, 0.0029 **** p<0.0001.

Article Snippet: One day prior to seeding myotube templates, black 96-well clear bottom plates (PerkinElmer, #6055300) were coated with 5 % pluronic acid (Sigma-Aldrich, #P2443) and incubated overnight at 4 °C.

Techniques: Isolation

Journal: bioRxiv

Article Title: Rescue of aged muscle stem cell intrinsic quiescence defects by AKT inhibition revealed with a 3D biomimetic culture assay

doi: 10.1101/2022.06.15.496252

Figure Lengend Snippet: (A) Representative confocal image of a mononuclear cell (DAPI: cyan) positive for YFP (yellow), caveolin-1 (magenta) and c-FOS (white) at 1 DPE (Top), and a c-FOS - cell at 7 DPE (Bottom). Scale bar, 20 µm. (B) Stacked bar graph showing proportions of c-FOS+/ - cells at 1, 3 and 7 DPE in the DAPI + YFP + Cav-1 + population. n=9 across N=3 independent biological replicates. Graph displays mean ± s.e.m. for c-FOS + and c-FOS - ; one-way ANOVA with Tukey post-test comparing the FOS - proportions of each timepoint, **** p<0.0001. (C) Stacked bar graph showing proportions of Ki67+/- cells at 1, 3 and 7 DPE in the DAPI + YFP + Pax7 + population. n=10-11 across N=3-4 independent biological replicates. Graph displays mean ± s.e.m. for Ki67 + and Ki67 - ; one-way ANOVA with Tukey post-test comparing the Ki67 - proportions of each timepoint, **** p<0.000.1 (D) Timeline of EdU/Ki67 co-labelling experiment (made with BioRender). (E) Stacked bar graph showing proportions of EdU+/- cells at 7 DPE in the DAPI + YFP + Ki67 - mononuclear cell population. n=15 across N=5 independent biological replicates. Graph displays mean ± s.e.m. for EdU + and EdU - . (F) Representative confocal stitched images of myotube templates (SAA: magenta) 2 days after a 4-hour exposure to the physiological salt solution (PSS) control or a 2.4 % barium chloride (BaCl 2 ) solution. Scale bar, 1 mm. (G) Proportion of Ki67+/- cells at 2 DPI in the DAP + YFP + Pax7 + population. n=16, 18 across N=5, 6 biological replicates. Graph displays mean ± s.e.m. for Ki67 + and Ki67 - ; unpaired t-test of the Ki67 - proportions of both conditions, **** p<0.0001

Article Snippet: One day prior to seeding myotube templates, black 96-well clear bottom plates (PerkinElmer, #6055300) were coated with 5 % pluronic acid (Sigma-Aldrich, #P2443) and incubated overnight at 4 °C.

Techniques: Control

Journal: bioRxiv

Article Title: Rescue of aged muscle stem cell intrinsic quiescence defects by AKT inhibition revealed with a 3D biomimetic culture assay

doi: 10.1101/2022.06.15.496252

Figure Lengend Snippet: (A) Key for figure icons. (B-F) Line graphs of mononucleated DAPI + YFP + Pax7 + cell density at 1, 3 and 7 DPE (left) and pie charts showing the proportion of Ki67+/- cells at 7 DPE (right) for cells seeded into a 2D microwell with a Geltrex™ coating (B) , engrafted into 3D myotube templates on day 5 (C) vs day 0 (D) of differentiation. Additional comparisons include engraftment into a 3D cellulose reinforced extracellular matrix (ECM) hydrogel on day 5 (E) , or onto a 2D monolayer of myotubes with a Geltrex™ undercoating on day 5 of differentiation (F) . n=6-9 from N=2-3 independent biological replicates. Graphs display mean ± s.e.m.

Article Snippet: One day prior to seeding myotube templates, black 96-well clear bottom plates (PerkinElmer, #6055300) were coated with 5 % pluronic acid (Sigma-Aldrich, #P2443) and incubated overnight at 4 °C.

Techniques:

Journal: bioRxiv

Article Title: Rescue of aged muscle stem cell intrinsic quiescence defects by AKT inhibition revealed with a 3D biomimetic culture assay

doi: 10.1101/2022.06.15.496252

Figure Lengend Snippet: (A) Representative confocal image of a mononuclear donor cell (DAPI: cyan, YFP: yellow) with neighbouring myotubes (Phalloidin: magenta) and N-cadherin (white) localized to the tip of the donor cell projection (white arrowhead). Scale bar, 20 µm. (B) Representative confocal images of a mononuclear donor cell (DAPI: cyan, YFP: yellow) at 1 DPE (top) and 7 DPI (middle and bottom) expressing integrin α-7 (magenta) and M-cadherin (white). Middle inset image channels are separated to produce the bottom images to highlight the polarization of integrin α-7 and M-cadherin (white arrow) to basal and apical orientations, respectively (dotted lines). Scale bars, 20 µm.

Article Snippet: One day prior to seeding myotube templates, black 96-well clear bottom plates (PerkinElmer, #6055300) were coated with 5 % pluronic acid (Sigma-Aldrich, #P2443) and incubated overnight at 4 °C.

Techniques: Expressing

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation